Filters
Technology
Platform
SRP100835
Homo sapiens
3 Downloadable Samples
Illumina HiSeq 2500
Description
HeLa cells lacking MORC2 generated through CRISPR/Cas9-mediated gene disruption were reconstituted with either wild-type or R252W mutant MORC2, and re-repression of HUSH target genes assessed by RNA-seq Overall design: Total RNA-seq of MORC2 knockout cells, either 1) mock transduced, 2) transduced with lentiviral vector encoding wild-type MORC2 or 3) transduced with lentviral vector encoding R252W MORC2.
Publication Title
Hyperactivation of HUSH complex function by Charcot-Marie-Tooth disease mutation in MORC2.
Sample Metadata Fields
Cell line, Subject
View Samples- Homo sapiens
- 12 Downloadable Samples
Illumina human-6 v2.0 expression beadchip
Description
HES4 hESC were cultured in serum media and maintained on a layer of mouse embryonic fibroblast feeder cells at a density of 6 x 104 cells/cm2. For differentiation: hESC were differentiated for a total of 14 days. Differentiation was induced by passaging 4 human ES cell pieces onto 12 well plates seeded with 0.67 x 10E4 cells/cm2. Cells were maintained in media containing 20% FCS for 2 days before media containing 5% FCS was used. Reduced serum media was changed every second day for the remaining 12 days
Publication Title
Subfractionation of differentiating human embryonic stem cell populations allows the isolation of a mesodermal population enriched for intermediate mesoderm and putative renal progenitors.
Sample Metadata Fields
Specimen part
View Samples- Mus musculus
- 107 Downloadable Samples
- Affymetrix Mouse Genome 430 2.0 Array (mouse4302)
Description
Comparative analysis can provide important insights into complex biological systems. As demonstrated in the accompanying paper, Translating Ribosome Affinity Purification (TRAP), permits comprehensive studies of translated mRNAs in genetically defined cell populations following physiological perturbations.
Publication Title
Application of a translational profiling approach for the comparative analysis of CNS cell types.
Sample Metadata Fields
No sample metadata fields
View Samples- Mus musculus
- 4 Downloadable Samples
- Affymetrix Mouse Genome 430 2.0 Array (mouse4302)
Description
We developed a mouse line targeting midbrain dopamine neurons for Translating Ribosome Affinity Purification (TRAP). Here, we briefly report on the basic characterization of this mouse line including confirmation of expression of the transgene in midbrain dopamine neurons and validation of its effectiveness in capturing mRNA from these cells. We also report a translational profile of these neurons which may be of use to investigators studying the gene expression of these cells. Finally, we have donated the line to Jackson Laboratories for distribution and use in future studies.
Publication Title
Generation and characterization of a mouse line for monitoring translation in dopaminergic neurons.
Sample Metadata Fields
Sex, Specimen part
View Samples- Homo sapiens
- 18 Downloadable Samples
- IlluminaHiSeq2500
Description
Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5' and 3' untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5' untranslated regions exert robust translational control between cell lines, while 3' untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Overall design: Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
Publication Title
Tunable protein synthesis by transcript isoforms in human cells.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 72 Downloadable Samples
- Illumina HiSeq 2000
Description
The goal of the study was to analyze the principles governing the usage of alternatively spliced transcript isoform of four types of T-cells (Naïve, Central Memory, Transitional Memory and Effector Memory) between resting and activated status. However, the principles discovered in the T cells were universal and can also be applied to other cell type and tissues. Overall design: Four types of T cells were sorted and whole transcriptome analysis was performed using an Illumina machine The readme.txt contains the column headers and description for the processed data files.
Publication Title
Stochastic principles governing alternative splicing of RNA.
Sample Metadata Fields
Subject
View Samples- Mus musculus
- 9 Downloadable Samples
- Affymetrix Murine Genome U74A Version 2 Array (mgu74av2), Affymetrix Murine Genome U74A Array (mgu74a)
Description
Biological comparison of gene expression profiles of adult male whole Muta™Mouse lung with its immortalized 100% confluent epithelial lung cell line counterpart. White, P.A.,et al. 2003. Development and characterization of an epithelial cell line from Muta™Mouse lung. Environ Mol Mutagen 42,3 pgs 166-184
Publication Title
Comprehensive comparison of six microarray technologies.
Sample Metadata Fields
Sex, Specimen part, Cell line, Subject
View Samples- Arabidopsis thaliana
- 6 Downloadable Samples
- Affymetrix Arabidopsis ATH1 Genome Array (ath1121501)
Description
BP and ER encode proteins that act synergistically to regulate Arabidopsis inflorescence architecture. To search for genes/proteins that influence the BP/ER signaling pathways, we conducted mutagenesis of the bp er double mutant and found that a mutation in FILAMENTOUS FLOWER (FIL) suppresses many of the morphological/developmental defects in bp er. Given that FIL encodes a Zn-finger containing transcription factor, microarray analysis was conducted on bp er vs. the bp er fil line to identify genes that are misregulated and which might implicate specific genes/proteins/pathways that are involved in regulating inflorescence development.
Publication Title
A novel Filamentous Flower mutant suppresses brevipedicellus developmental defects and modulates glucosinolate and auxin levels.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 232 Downloadable Samples
- IlluminaHiSeq2000
Description
Immunity to malaria can be acquired through natural exposure to Plasmodium falciparum (Pf), but only after years of repeated infections. Typically, this immunity is acquired by adolescence and confers protection against disease, but not Pf infection per se. Efforts to understand the mechanisms of this immunity are integral to the development of a vaccine that would mimic the induction of adult immunity in children. The current study applies transcriptomic analyses to a cohort from the rural village of Kalifabougou, Mali, where Pf transmission is intense and seasonal. Signatures that correlate with protection from malaria may yield new hypotheses regarding the biological mechanisms through which malaria immunity is induced by natural Pf infection. The resulting datasets will be of considerable value in the urgent worldwide effort to develop a malaria vaccine that could prevent more than a million deaths annually. Overall design: 108 samples; paired pre- and post-challenge for 54 individuals 198 samples; paired pre- and post-challenge for 99 individuals
Publication Title
Transcriptomic evidence for modulation of host inflammatory responses during febrile Plasmodium falciparum malaria.
Sample Metadata Fields
No sample metadata fields
View Samples- Mus musculus
- 18 Downloadable Samples
- Affymetrix Mouse Gene 2.1 ST Array (mogene21st)
Description
Long chain fatty acids (LCFA) serve as energy sources, components of cell membranes, and precursors for signalling molecules. Here we show that these important biological compounds also regulate gene expression by controlling the transcriptional activities of the retinoic acid (RA)-activated nuclear receptors RAR and PPAR/. Our data indicates that these activities of LCFA are mediated by FABP5, a protein that delivers ligands from the cytosol to nuclear PPAR/. Both saturated and unsaturated LCFA (SLCFA, ULCFA) tightly bind to FABP5, thereby displacing RA and diverting it to RAR. However, while SLCFA inhibit, ULCFA activate the FABP5/PPAR/ pathway. By concomitantly promoting the activation of RAR and inhibiting the activity of PPAR/, SLCFA suppress the growth and oncogenic properties of FABP5-expressing carcinoma cells both in cultured cells and in vivo.
Publication Title
Saturated fatty acids regulate retinoic acid signalling and suppress tumorigenesis by targeting fatty acid-binding protein 5.
Sample Metadata Fields
Cell line
View Samples