Filters
Technology
Platform
GSE53454
Homo sapiens
86 Downloadable Samples
Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)
Description
In the context of T1 Diabetes, pro-inflammatory cytokines IL-1 and IFN- are known to contribute to -cell apoptosis;
Publication Title
Temporal profiling of cytokine-induced genes in pancreatic β-cells by meta-analysis and network inference.
Sample Metadata Fields
Specimen part, Treatment, Time
View Samples- Rattus norvegicus
- 40 Downloadable Samples
- Affymetrix Rat Gene 1.0 ST Array (ragene10st)
Description
In the context of T1 Diabetes, pro-inflammatory cytokines IL-1 and IFN- are known to contribute to -cell apoptosis;
Publication Title
Temporal profiling of cytokine-induced genes in pancreatic β-cells by meta-analysis and network inference.
Sample Metadata Fields
Cell line, Treatment, Time
View Samples- Homo sapiens
- 2 Downloadable Samples
IlluminaGenomeAnalyzerII
Description
ERa is essential for the anti-proliferative response of breast cancer cells not only to estrogen antagonists, but also to estrogen withdrawal by means of aromatase inhibitors. We explored here one of the simplest explanation for this, consisting in the possibility that ERa may have a wide genomic function in absence of ligands. The genomic binding of ERa in the complete absence of estrogen was then studied using hormone-dependent MCF7 cells, by chromatin immunoprecipitation sequencing. From these data, 4.2K highly significant binding events were identified, which were further confirmed by comparing binding events in cells expressing ERa to cells silenced for ERa. Apo-ERa binding sites were distributed close to genes with functions associated to cell growth and epithelial maintenance and show significant overlap with binding of other transcription factors important for luminal epithelial breast cancer. Interestingly, we found that upon ERa silencing cognate gene transcription in absence of estrogen is downregulated and this is accompanied by increased H27Kme3 at ERa binding sites. RNA-Seq experiments showed that unliganded ERa controls basal transcription widely, including both coding and noncoding transcripts. Genes affected by ERa silencing can be easily functionally related to mammary epithelium differentiation and maintenance, especially when considering downregulated genes. Additional functions related to inflammatory and immune response was observed. Our data unravel unexpected actions of ERa in breast cancer cells and provide a novel framework to understand success and failure of hormone therapy in breast cancer. Overall design: Examination of unligandend estrogen receptor alpha (aERa) DNA interactions in control and aERa siRNA treated MCF7 cells.
Publication Title
Dissecting the genomic activity of a transcriptional regulator by the integrative analysis of omics data.
Sample Metadata Fields
No sample metadata fields
View Samples- Mus musculus
- 6 Downloadable Samples
- Illumina HiSeq 2500
Description
Purpose: Homeostatic control of vascular smooth muscle cell (VSMC) differentiation is critical for contractile activity and regulation of blood flow. Recently, we reported that pre-contracted blood vessels are relaxed and the phenotype of VSMC is regulated from a synthetic to contractile state by glucose-6-phosphate dehydrogenase (G6PD) inhibition. In the current study, we investigated whether the increase in the expression of VSMC contractile proteins by inhibition and knockdown of G6PD is mediated through a protein kinase G (PKG)-dependent pathway and whether it regulates blood pressure Methods: Coronary arteries (LAD) isolated from bovine heart mRNA profiles of 12-16 week old wild type (WT) and G6PD-deficient mice were generated by deep sequencing, in triplicate, using Illumina HiSeq 2500. The sequence reads that passed quality filters (Trimmomatic-0.32) were analyzed at the transcript isoform level using STAR_2.4.2a for mapping to reference GRCm38.p4 + Gencode-M6 Annotation and processed with Cufflinks-2.0.2. miR analysis was performed by quantitative RT-PCR (qRT-PCR) for validation using miR-specific TaqMan miR assays (Applied Biosystems, Foster City, CA). Quantitative PCR was performed in triplicate using TaqMan Universal PCR Master mix. Standard curves were made for each miR using synthetic miR oligonucleotides (IDT, Coralville, IA) with the following sequence: Rno-miR-145: GUCCAGUUUUCCCAGGAAUCCCU, Rno-miR-1: UGGAAUGUAAAGAAGUGUGUAU, Rno-miR-143: UGAGAUGAAGCACUGUAGCUC, Rno-miR-133a: UUUGGUCCCCUUCAACCAGCUG Results: We found that the expression of VSMC-restricted contractile proteins, myocardin (MYOCD), and miR-1 and miR-143 are increased by G6PD inhibition or knockdown. Importantly, RNA-sequence analysis of aortic tissue from G6PD-deficient mice revealed uniform increases in VSMC-restricted genes, particularly those regulated by the MYOCD-serum response factor (SRF) switch. Conversely, expression of Krüppel-like factor 4 (KLF4) is decreased by G6PD inhibition. Interestingly, the G6PD inhibition-induced expression of miR-1 and contractile proteins was blocked by Rp-ß-phenyl-1,N2-etheno-8-bromo-guanosine-3’,5’-cyclic monophosphorothioate, a PKG inhibitor. On the other hand, MYOCD and miR-143 levels are increased by G6PD inhibition through a PKG-independent manner. Furthermore, blood pressure was lower in the G6PD-deficient as compared to wild-type mice Conclusions: Therefore, our results suggest that the expression of VSMC contractile proteins induced by G6PD inhibition occurs via PKG1?-dependent and –independent pathways Overall design: Coronary arteries (LAD) isolated from bovine heart mRNA profiles of 12-16 week old wild type (WT) and G6PD-deficient mice were generated by deep sequencing, in triplicate, using Illumina HiSeq 2500 genotype/variation: CYPKO: Sample 1,Sample 2,Sample 3 genotype/variation: G6PD: Sample 4,Sample 5,Sample 6 biological replicate: Sample 1,Sample 2,Sample 3 biological replicate: Sample 4,Sample 5,Sample 6
Publication Title
Vascular smooth muscle cell contractile protein expression is increased through protein kinase G-dependent and -independent pathways by glucose-6-phosphate dehydrogenase inhibition and deficiency.
Sample Metadata Fields
Specimen part, Subject
View Samples- Homo sapiens
- 55 Downloadable Samples
- Illumina HiSeq 2000
Description
Prior studies using DNA microarray platforms have shown alterations of gene expression profiles (GEPs) of marrow cells in myelodysplastic syndromes (MDS). Using the increased sensitivity and accuracy of high-throughput RNA sequencing (RNA-Seq) for detecting and quantifying mRNA transcripts, our study has demonstrated novel significant differences in GEPs between MDS and normal CD34+ marrow cells with 41 genes identified as disease classifiers. Additionally, two main clusters of GEPs distinguished patients based on their major clinical features, particularly between those whose disease remained stable (sMDS) vs patients whose illness transformed to acute myeloid leukemia within 12 months (tMDS). The genes whose expression was associated with disease outcome were involved in functional pathways and biologic processes highly relevant for MDS. Exomic analysis identified MDS-associated pathogenic mutations in virtually all patients tested. MDS subgroups with spliceosome mutations demonstrated distinct differential isoform usage and expression and consequent dysregulation of distinct biological functions. This combination of clinical, transcriptomic and exomic findings provides valuable molecular insights into the mechanisms underlying MDS and its progression to a more aggressive stage and also facilitates prognostic characterization of MDS patients. Overall design: RNA-Seq was performed on CD34+ hematopoietic stem cells derived from healthy individuals and patients with myelodysplastic syndrome.
Publication Title
Distinct transcriptomic and exomic abnormalities within myelodysplastic syndrome marrow cells.
Sample Metadata Fields
Specimen part, Disease, Subject
View Samples- Mus musculus
- 10 Downloadable Samples
- Affymetrix Mouse Genome 430 2.0 Array (mouse4302)
Description
In this study, murine primary aortic smooth muscle cells (SMCs) were transcriptionally profiled at baseline, after 3 d of cholesterol loading, and after 3 d of subsequent cholesterol unloading with HDL treatment, to identify vascular SMC genes that are transcripionally dysregulated in response to cholesterol loading and/or unloading.
Publication Title
Cholesterol loading reprograms the microRNA-143/145-myocardin axis to convert aortic smooth muscle cells to a dysfunctional macrophage-like phenotype.
Sample Metadata Fields
Age, Specimen part
View Samples- Homo sapiens
- 9 Downloadable Samples
- IlluminaHiSeq2000
Description
RNA sequencing (RNA-seq) analysis revealed 31 novel lncRNAs in HCASMC, including a vascular cell-enriched lncRNA called SENCR (for Smooth muscle and Endothelial cell long Non-Coding RNA). RT-PCR and hybridization studies show SENCR exists in two isoforms and is transcribed antisense from the 5’ end of the FLI1 gene. Knockdown of SENCR has no effect on FLI1 mRNA or protein expression. Biochemical fractionation and RNA fluorescence in situ hybridization (FISH) studies indicate SENCR is a cytoplasmic lncRNA. RNA-seq experiments in HCASMC where SENCR is attenuated disclose decreased expression of Myocardin and many SMC contractile genes; conversely a pro-migratory gene signature is increased. RT-PCR and Western blotting validated several differentially expressed genes following SENCR knockdown. Loss-of-function studies in scratch wound and Boyden chamber assays support SENCR as an inhibitor of vascular cell migration. Overall design: Total RNAs of 3 replicates of normal human coronary artery smooth muscle cells (Mock1, Mock2 and Mock3) were sequenced and analyzed for identification of novel lncRNAs. One of identified novel lncRNAs from that experiment is SENCR. To study its function, SENCR knock-down experiment were performed and then RNA-seq profiles of 3 replicates of both SENCR-knockdown samples and corresponding controls were compared.
Publication Title
Identification and initial functional characterization of a human vascular cell-enriched long noncoding RNA.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 4 Downloadable Samples
- Illumina HumanHT-12 V4.0 expression beadchip
Description
Analysis of transcriptomic fidelity between primary and pdx tumor. The hypothesis tested in the present study was that pdx can serve as high fidelity models of human cancer and guide longitudinal care. Results provide important information on the response of preservation of gene expression changes between the primary tumor and the first generation pdx.
Publication Title
Case study: patient-derived clear cell adenocarcinoma xenograft model longitudinally predicts treatment response.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 45 Downloadable Samples
- Affymetrix Human Exon 1.0 ST Array [transcript (gene) version (huex10st)
Description
Hypoxia may cause pulmonary and brain edema, pulmonary hypertension, aberrant metabolism and early mortality. To better understand pathological processes associated with hypoxia, we examined gene expression in Chuvash polycythemia (CP) blood mononuclear cells. CP is a congenital disorder of up-regulated hypoxic response at normoxia wherein VHLR200W homozygosity leads to elevated hypoxia inducible factor (HIF)-1 and HIF-2 levels, thromboses, pulmonary hypertension, lower systemic blood pressure (SBP) and increased mortality. VHLR200W homozygotes are often treated by phlebotomy resulting in iron deficiency, allowing us to evaluate an interaction of augmented hypoxia sensing with iron deficiency.
Publication Title
Iron deficiency modifies gene expression variation induced by augmented hypoxia sensing.
Sample Metadata Fields
Sex, Specimen part
View Samples- Homo sapiens
- 602 Downloadable Samples
- Affymetrix Human Exon 1.0 ST Array [transcript (gene) version (huex10st)
Description
Innovative approaches combining regulatory networks and genomic data are needed to extract pertinent biological informations to a better understanding of complex disease such as cancer and improve identi cation of entities leading to potential new therapeutic avenues. In this study, we confronted an automatic generated regulatory network with gene expression pro les (GEP) from a large cohort of patients with multiple myeloma (MM) and normal individuals with a causality reasonning method based of graph coloring to identify keynodes. Due to this causality reasoning, it is possible to infer proteins state from these GEP. Also, our method is able to simulate the impact of the perturbation of a node in this regulatory network to identify therapeutic targets. This method allowed us to nd that JUN/FOS and FOXM1, known in MM, and their inhibition as speci c to large group of patients with MM. Moreover, we associated the inhibition of FOXM1 activity with good prognosis, suggesting the inhibition of FOXM1 activity could be a survival marker. Finally, if JUN/FOS activation seems to be a way to strongly perturb the regulatory network in view of GEP, our result suggests the activation of FOXM1 could be interesting way to perturb some sub-group of profiles.
Publication Title
Logic programming reveals alteration of key transcription factors in multiple myeloma.
Sample Metadata Fields
Specimen part, Disease, Disease stage
View Samples